How Humankind Created Science

Download How Humankind Created Science full books in PDF, epub, and Kindle. Read online How Humankind Created Science ebook anywhere anytime directly on your device. Fast Download speed and no annoying ads. We cannot guarantee that every ebooks is available!

How Humankind Created Science

Author : Falin Chen
Publisher : Springer Nature
ISBN 13 : 3030431355
Total Pages : 601 pages
Book Rating : 4.0/5 (34 download)

DOWNLOAD NOW!

Book Synopsis How Humankind Created Science by : Falin Chen

Download or read book How Humankind Created Science written by Falin Chen and published by Springer Nature. This book was released on 2020-04-27 with total page 601 pages. Available in PDF, EPUB and Kindle. Book excerpt: The development of science has been an ideological struggle that lasted over three millennia. At and after the times of the Babylonian Empire, however, the pace of scientific evolution was painfully slow. This situation changed after Copernicus kick-started the Scientific Revolution with his heliocentric theory. Newton’s law of universal gravitation transformed natural philosophy, previously focused on mythology and abstract philosophical thinking, into an orderly and rational physical science. Einstein’s redefinition of space and time revealed a new and central principle of the Universe, paving the way for the huge amounts of energy held deep inside physical matter to be released. To this day, many of the our known physical theories represent an accumulation of changing knowledge over the long course of scientific history. But what kind of changes did the scientists see? What questions did they address? What methods did they use? What difficulties did they encounter? And what kind of persecution might they have faced on the road to discovering these beautiful, sometimes almost mystical, ideas? This book’s purpose is to investigate these questions. It leads the reader through the stories behind major scientific advancements and their theories, as well as explaining associated examples and hypotheses. Over the course of the journey, readers will come to understand the way scientists explore nature and how scientific theories are applied to natural phenomena and every-day technology.

Shaping Humanity

Author : John Gurche
Publisher : Yale University Press
ISBN 13 : 0300182023
Total Pages : 364 pages
Book Rating : 4.3/5 (1 download)

DOWNLOAD NOW!

Book Synopsis Shaping Humanity by : John Gurche

Download or read book Shaping Humanity written by John Gurche and published by Yale University Press. This book was released on 2013-11-26 with total page 364 pages. Available in PDF, EPUB and Kindle. Book excerpt: Describes the process by which the author uses knowledge of fossil discoveries and comparative ape and human anatomy to create forensically accurate representations of human beings' ancient ancestors.

Science and Creationism

Author : National Academy of Sciences (U.S.)
Publisher : National Academies Press
ISBN 13 : 9780309064064
Total Pages : 48 pages
Book Rating : 4.0/5 (64 download)

DOWNLOAD NOW!

Book Synopsis Science and Creationism by : National Academy of Sciences (U.S.)

Download or read book Science and Creationism written by National Academy of Sciences (U.S.) and published by National Academies Press. This book was released on 1999 with total page 48 pages. Available in PDF, EPUB and Kindle. Book excerpt: This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)

Milestones of Science

Author : Curt Suplee
Publisher : National Geographic Society
ISBN 13 :
Total Pages : 296 pages
Book Rating : 4.:/5 (318 download)

DOWNLOAD NOW!

Book Synopsis Milestones of Science by : Curt Suplee

Download or read book Milestones of Science written by Curt Suplee and published by National Geographic Society. This book was released on 2000 with total page 296 pages. Available in PDF, EPUB and Kindle. Book excerpt: Chronicles three thousand years of scientific inquiry, covering such eras as the Classical Era, the Middle Ages, the Revolution, the Age of Reason, and the nineteenth and twentieth centuries.

The Alchemy of Us

Author : Ainissa Ramirez
Publisher : MIT Press
ISBN 13 : 0262542269
Total Pages : 392 pages
Book Rating : 4.2/5 (625 download)

DOWNLOAD NOW!

Book Synopsis The Alchemy of Us by : Ainissa Ramirez

Download or read book The Alchemy of Us written by Ainissa Ramirez and published by MIT Press. This book was released on 2021-04-06 with total page 392 pages. Available in PDF, EPUB and Kindle. Book excerpt: A “timely, informative, and fascinating” study of 8 inventions—and how they shaped our world—with “totally compelling” insights on little-known inventors throughout history (Elizabeth Kolbert, Pulitzer Prize–winning author of The Sixth Extinction) In The Alchemy of Us, scientist and science writer Ainissa Ramirez examines 8 inventions and reveals how they shaped the human experience: • Clocks • Steel rails • Copper communication cables • Photographic film • Light bulbs • Hard disks • Scientific labware • Silicon chips Ramirez tells the stories of the woman who sold time, the inventor who inspired Edison, and the hotheaded undertaker whose invention pointed the way to the computer. She describes how our pursuit of precision in timepieces changed how we sleep; how the railroad helped commercialize Christmas; how the necessary brevity of the telegram influenced Hemingway’s writing style; and how a young chemist exposed the use of Polaroid’s cameras to create passbooks to track black citizens in apartheid South Africa. These fascinating and inspiring stories offer new perspectives on our relationships with technologies. Ramirez shows not only how materials were shaped by inventors but also how those materials shaped culture, chronicling each invention and its consequences—intended and unintended. Filling in the gaps left by other books about technology, Ramirez showcases little-known inventors—particularly people of color and women—who had a significant impact but whose accomplishments have been hidden by mythmaking, bias, and convention. Doing so, she shows us the power of telling inclusive stories about technology. She also shows that innovation is universal—whether it's splicing beats with two turntables and a microphone or splicing genes with two test tubes and CRISPR.

The Language of God

Author : Francis Collins
Publisher : Simon and Schuster
ISBN 13 : 1847396151
Total Pages : 304 pages
Book Rating : 4.8/5 (473 download)

DOWNLOAD NOW!

Book Synopsis The Language of God by : Francis Collins

Download or read book The Language of God written by Francis Collins and published by Simon and Schuster. This book was released on 2008-09-04 with total page 304 pages. Available in PDF, EPUB and Kindle. Book excerpt: Dr Francis S. Collins, head of the Human Genome Project, is one of the world's leading scientists, working at the cutting edge of the study of DNA, the code of life. Yet he is also a man of unshakable faith in God. How does he reconcile the seemingly unreconcilable? In THE LANGUAGE OF GOD he explains his own journey from atheism to faith, and then takes the reader on a stunning tour of modern science to show that physics, chemistry and biology -- indeed, reason itself -- are not incompatible with belief. His book is essential reading for anyone who wonders about the deepest questions of all: why are we here? How did we get here? And what does life mean?

Science But Not Scientists

Author : Vernon L. Grose
Publisher : AuthorHouse
ISBN 13 : 9781425969929
Total Pages : 748 pages
Book Rating : 4.9/5 (699 download)

DOWNLOAD NOW!

Book Synopsis Science But Not Scientists by : Vernon L. Grose

Download or read book Science But Not Scientists written by Vernon L. Grose and published by AuthorHouse. This book was released on 2006-10 with total page 748 pages. Available in PDF, EPUB and Kindle. Book excerpt: The historic Science Textbook Struggle -- a worldwide battle about the origin of the universe, life, and man -- erupted without warning. It caught the scientific illuminati completely by surprise. Why? Because science textbooks had become filled with wild, unbelievable stories about the beginning of everything. And those tales were simply not scientific! The universe starting with a Big Bang, life arising out of a soup of lifeless amino-acids, humans produced by apes . . . those myths had only replaced ancient Greek mythology- and were being passed off as scientific truths! Caught in the crossfire between educators, news media, textbook publishers, religious notables, and world renowned scientists- -- including nineteen Nobel laureates -- was a private citizen. Father of six schoolchildren, he had only one goal: - to prove that science never will have answers for origins! He was up against the arrogance of scientists who were determined to disguise their private beliefs as being the only explanations for the origin of the universe, life, and man. This story concludes with a great victory for objectivity -- with more than 200 changes being made in textbooks --- over the objections of the National Academy of Sciences. All discussion about origins was transformed -- by admission that stories about them are based solely on personal views of individual scientists. Remarkably, 3,000 scientists around the world later signed an affirmation to assure that this issue of belief-over-fact in science never be repeated. Wernher von Braun, father of America's space program, writes in the Foreword: "Vernon Grose, in tracing out in Science But Not Scientists his personal involvement in the vortex of these two forces, illustrates one more time the humanity of scientists - their likelihood of being just as prejudiced and bigoted as anyone untrained in science. He properly calls for objectivity rather than scientific consensus. He rightly urges that message rather than messenger should be scrutinized and tested for validity. Science will be the richer and humanity the ultimate beneficiary by heeding this clarion call."

Return of the God Hypothesis

Author : Stephen C. Meyer
Publisher : HarperCollins
ISBN 13 : 0062071521
Total Pages : 576 pages
Book Rating : 4.0/5 (62 download)

DOWNLOAD NOW!

Book Synopsis Return of the God Hypothesis by : Stephen C. Meyer

Download or read book Return of the God Hypothesis written by Stephen C. Meyer and published by HarperCollins. This book was released on 2021-03-30 with total page 576 pages. Available in PDF, EPUB and Kindle. Book excerpt: The New York Times bestselling author of Darwin’s Doubt presents groundbreaking scientific evidence of the existence of God, based on breakthroughs in physics, cosmology, and biology. Beginning in the late 19th century, many intellectuals began to insist that scientific knowledge conflicts with traditional theistic belief—that science and belief in God are “at war.” Philosopher of science Stephen Meyer challenges this view by examining three scientific discoveries with decidedly theistic implications. Building on the case for the intelligent design of life that he developed in Signature in the Cell and Darwin’s Doubt, Meyer demonstrates how discoveries in cosmology and physics coupled with those in biology help to establish the identity of the designing intelligence behind life and the universe. Meyer argues that theism—with its affirmation of a transcendent, intelligent and active creator—best explains the evidence we have concerning biological and cosmological origins. Previously Meyer refrained from attempting to answer questions about “who” might have designed life. Now he provides an evidence-based answer to perhaps the ultimate mystery of the universe. In so doing, he reveals a stunning conclusion: the data support not just the existence of an intelligent designer of some kind—but the existence of a personal God.

Science and Human Origins

Author : Ann Gauger
Publisher : Discovery Institute
ISBN 13 : 9781936599042
Total Pages : 0 pages
Book Rating : 4.5/5 (99 download)

DOWNLOAD NOW!

Book Synopsis Science and Human Origins by : Ann Gauger

Download or read book Science and Human Origins written by Ann Gauger and published by Discovery Institute. This book was released on 2012 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Evidence for a purely Darwinian account of human origins is supposed to be overwhelming. But is it? In this provocative book, three scientists challenge the claim that undirected natural selection is capable of building a human being, critically assess fossil and genetic evidence that human beings share a common ancestor with apes, and debunk recent claims that the human race could not have started from an original couple.

Life as We Made It

Author : Beth Shapiro
Publisher : Basic Books
ISBN 13 : 1541644158
Total Pages : 313 pages
Book Rating : 4.5/5 (416 download)

DOWNLOAD NOW!

Book Synopsis Life as We Made It by : Beth Shapiro

Download or read book Life as We Made It written by Beth Shapiro and published by Basic Books. This book was released on 2021-10-19 with total page 313 pages. Available in PDF, EPUB and Kindle. Book excerpt: From the first dog to the first beefalo, from farming to CRISPR, the human history of remaking nature When the 2020 Nobel Prize was awarded to the inventors of CRISPR, the revolutionary gene-editing tool, it underlined our amazing and apparently novel powers to alter nature. But as biologist Beth Shapiro argues in Life as We Made It, this phenomenon isn’t new. Humans have been reshaping the world around us for ages, from early dogs to modern bacteria modified to pump out insulin. Indeed, she claims, reshaping nature—resetting the course of evolution, ours and others’—is the essence of what our species does. In exploring our evolutionary and cultural history, Shapiro finds a course for the future. If we have always been changing nature to help us survive and thrive, then we need to avoid naive arguments about how we might destroy it with our meddling, and instead ask how we can meddle better. Brilliant and insightful, Life as We Made It is an essential book for the decades to come.

I Wish I'd Made You Angry Earlier

Author : Max F. Perutz
Publisher : Oxford University Press, USA
ISBN 13 : 9780198590279
Total Pages : 388 pages
Book Rating : 4.5/5 (92 download)

DOWNLOAD NOW!

Book Synopsis I Wish I'd Made You Angry Earlier by : Max F. Perutz

Download or read book I Wish I'd Made You Angry Earlier written by Max F. Perutz and published by Oxford University Press, USA. This book was released on 2002 with total page 388 pages. Available in PDF, EPUB and Kindle. Book excerpt: This collection of essays from Nobel Laureate Max Perutz explores a wide range of scientific and personal topics with insight and lucidity. It includes lively anecdotes about key figures in 20th-century science.

How New Humans Are Made

Author : Charles E. Boklage
Publisher : World Scientific
ISBN 13 : 9812835148
Total Pages : 516 pages
Book Rating : 4.8/5 (128 download)

DOWNLOAD NOW!

Book Synopsis How New Humans Are Made by : Charles E. Boklage

Download or read book How New Humans Are Made written by Charles E. Boklage and published by World Scientific. This book was released on 2010 with total page 516 pages. Available in PDF, EPUB and Kindle. Book excerpt: It is not okay to call something a miracle without even trying to understand it. This is human developmental biology (human embryology, in terms of cells and molecules) for everyone curious enough to see it through, from the perspective of the business of becoming human as individuals and as species; making new humans; how it happens (cells do it, ALL of it); and common variations of the process. It cannot be made quite simple and be kept quite true, but we will move as far toward simple as we can without losing touch with sound evidence. Variations from the normal version of the process, particularly malformations and twinning and chimerism, figure prominently in the story because there is no better way to learn about the usual than to study the unusual and see what differences in the endings these observable differences at the beginnings can make. In this book, when technical terminology is the only way, or the best way, to say what needs to be said, it is defined and explained making the words a worthwhile part of what is here to be learned. This book defines its own new field. We cannot claim to understand how anything human] works as human], with no effort at understanding the emergence of its form and functions. Old and new unanswered questions are waiting to be dug out from under old unquestioned answers about how becoming human unfolds. We will also address some popular and weighty, but deeply empty assertions about the circumstances and mechanisms of our beginnings and our ceaseless becoming. We will find fundamental questions from the humanities' unanswerable except from biology. Human developmental biology is a foundational discipline within the humanities.

The Knowledge Machine: How Irrationality Created Modern Science

Author : Michael Strevens
Publisher : Liveright Publishing
ISBN 13 : 1631491385
Total Pages : 368 pages
Book Rating : 4.6/5 (314 download)

DOWNLOAD NOW!

Book Synopsis The Knowledge Machine: How Irrationality Created Modern Science by : Michael Strevens

Download or read book The Knowledge Machine: How Irrationality Created Modern Science written by Michael Strevens and published by Liveright Publishing. This book was released on 2020-10-13 with total page 368 pages. Available in PDF, EPUB and Kindle. Book excerpt: “The Knowledge Machine is the most stunningly illuminating book of the last several decades regarding the all-important scientific enterprise.” —Rebecca Newberger Goldstein, author of Plato at the Googleplex A paradigm-shifting work, The Knowledge Machine revolutionizes our understanding of the origins and structure of science. • Why is science so powerful? • Why did it take so long—two thousand years after the invention of philosophy and mathematics—for the human race to start using science to learn the secrets of the universe? In a groundbreaking work that blends science, philosophy, and history, leading philosopher of science Michael Strevens answers these challenging questions, showing how science came about only once thinkers stumbled upon the astonishing idea that scientific breakthroughs could be accomplished by breaking the rules of logical argument. Like such classic works as Karl Popper’s The Logic of Scientific Discovery and Thomas Kuhn’s The Structure of Scientific Revolutions, The Knowledge Machine grapples with the meaning and origins of science, using a plethora of vivid historical examples to demonstrate that scientists willfully ignore religion, theoretical beauty, and even philosophy to embrace a constricted code of argument whose very narrowness channels unprecedented energy into empirical observation and experimentation. Strevens calls this scientific code the iron rule of explanation, and reveals the way in which the rule, precisely because it is unreasonably close-minded, overcomes individual prejudices to lead humanity inexorably toward the secrets of nature. “With a mixture of philosophical and historical argument, and written in an engrossing style” (Alan Ryan), The Knowledge Machine provides captivating portraits of some of the greatest luminaries in science’s history, including Isaac Newton, the chief architect of modern science and its foundational theories of motion and gravitation; William Whewell, perhaps the greatest philosopher-scientist of the early nineteenth century; and Murray Gell-Mann, discoverer of the quark. Today, Strevens argues, in the face of threats from a changing climate and global pandemics, the idiosyncratic but highly effective scientific knowledge machine must be protected from politicians, commercial interests, and even scientists themselves who seek to open it up, to make it less narrow and more rational—and thus to undermine its devotedly empirical search for truth. Rich with illuminating and often delightfully quirky illustrations, The Knowledge Machine, written in a winningly accessible style that belies the import of its revisionist and groundbreaking concepts, radically reframes much of what we thought we knew about the origins of the modern world.

On Being Human

Author : Daisaku Ikeda
Publisher : PUM
ISBN 13 : 276061798X
Total Pages : 263 pages
Book Rating : 4.7/5 (66 download)

DOWNLOAD NOW!

Book Synopsis On Being Human by : Daisaku Ikeda

Download or read book On Being Human written by Daisaku Ikeda and published by PUM. This book was released on 2002 with total page 263 pages. Available in PDF, EPUB and Kindle. Book excerpt: À première vue, l'humanisme occidental, le bouddhisme japonais et la science moderne ont si peu en commun que l'idée même de rechercher un terrain d'entente par le dialogue semble trop idéaliste. Seul un homme du calibre de daisaku ikeda pourrait mener à bien un tel projet. Faisant fi du cliché et des réponses faciles, il aborde les grandes questions auxquelles la société d'aujourd'hui est confrontée: cancer, sida, mort dignement, fécondation in vitro, éthique biomédicale... Les réponses apportées par René Simard, biologiste moléculaire et généticien, et Guy Bourgeault, bioéthicien , sont perspicaces et convaincantes. Leurs discussions ont franchi les barrières linguistiques et culturelles pour présenter une vision du potentiel - et des défis inhérents - à l'être humain.

Creation

Author : Adam Rutherford
Publisher : Penguin UK
ISBN 13 : 0141970227
Total Pages : 272 pages
Book Rating : 4.1/5 (419 download)

DOWNLOAD NOW!

Book Synopsis Creation by : Adam Rutherford

Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Dawn of Everything

Author : David Graeber
Publisher : Farrar, Straus and Giroux
ISBN 13 : 0374721106
Total Pages : 384 pages
Book Rating : 4.3/5 (747 download)

DOWNLOAD NOW!

Book Synopsis The Dawn of Everything by : David Graeber

Download or read book The Dawn of Everything written by David Graeber and published by Farrar, Straus and Giroux. This book was released on 2021-11-09 with total page 384 pages. Available in PDF, EPUB and Kindle. Book excerpt: INSTANT NEW YORK TIMES BESTSELLER A dramatically new understanding of human history, challenging our most fundamental assumptions about social evolution—from the development of agriculture and cities to the origins of the state, democracy, and inequality—and revealing new possibilities for human emancipation. For generations, our remote ancestors have been cast as primitive and childlike—either free and equal innocents, or thuggish and warlike. Civilization, we are told, could be achieved only by sacrificing those original freedoms or, alternatively, by taming our baser instincts. David Graeber and David Wengrow show how such theories first emerged in the eighteenth century as a conservative reaction to powerful critiques of European society posed by Indigenous observers and intellectuals. Revisiting this encounter has startling implications for how we make sense of human history today, including the origins of farming, property, cities, democracy, slavery, and civilization itself. Drawing on pathbreaking research in archaeology and anthropology, the authors show how history becomes a far more interesting place once we learn to throw off our conceptual shackles and perceive what’s really there. If humans did not spend 95 percent of their evolutionary past in tiny bands of hunter-gatherers, what were they doing all that time? If agriculture, and cities, did not mean a plunge into hierarchy and domination, then what kinds of social and economic organization did they lead to? The answers are often unexpected, and suggest that the course of human history may be less set in stone, and more full of playful, hopeful possibilities, than we tend to assume. The Dawn of Everything fundamentally transforms our understanding of the human past and offers a path toward imagining new forms of freedom, new ways of organizing society. This is a monumental book of formidable intellectual range, animated by curiosity, moral vision, and a faith in the power of direct action. Includes Black-and-White Illustrations

Science, Society, and the Search for Life in the Universe

Author : Bruce M. Jakosky
Publisher : University of Arizona Press
ISBN 13 : 0816550921
Total Pages : 162 pages
Book Rating : 4.8/5 (165 download)

DOWNLOAD NOW!

Book Synopsis Science, Society, and the Search for Life in the Universe by : Bruce M. Jakosky

Download or read book Science, Society, and the Search for Life in the Universe written by Bruce M. Jakosky and published by University of Arizona Press. This book was released on 2022-10-18 with total page 162 pages. Available in PDF, EPUB and Kindle. Book excerpt: Are we alone in the universe? As humans, are we unique or are we part of a greater cosmic existence? What is life’s future on Earth and beyond? How does life begin and develop? These are age-old questions that have inspired wonder and controversy ever since the first people looked up into the sky. With today’s technology, however, we are closer than ever to finding the answers. Astrobiology is the relatively new, but fast growing scientific discipline that involves trying to understand the origin, evolution, and distribution of life within the universe. It is also one of the few scientific disciplines that attracts the public’s intense curiosity and attention. This interest stems largely from the deep personal meaning that the possible existence of extraterrestrial life has for so many. Whether this meaning relates to addressing the “Big Questions” of our existence, the possibility of encountering life on other planets, or the potential impact on our understanding of religion, there is no doubt that the public is firmly vested in finding answers. In this broadly accessible introduction to the field, Bruce Jakosky looks at the search for life in the universe not only from a scientific perspective, but also from a distinctly social one. In lucid and engaging prose, he addresses topics including the contradiction between the public’s fascination and the meager dialogue that exists between those within the scientific community and those outside of it, and what has become some of the most impassioned political wrangling ever seen in government science funding.