From One Cell A Journey Into Lifes Origins And The Future Of Medicine

Download From One Cell A Journey Into Lifes Origins And The Future Of Medicine full books in PDF, epub, and Kindle. Read online From One Cell A Journey Into Lifes Origins And The Future Of Medicine ebook anywhere anytime directly on your device. Fast Download speed and no annoying ads. We cannot guarantee that every ebooks is available!

From One Cell: A Journey into Life's Origins and the Future of Medicine

Author : Ben Stanger
Publisher : W. W. Norton & Company
ISBN 13 : 1324005432
Total Pages : 448 pages
Book Rating : 4.3/5 (24 download)

DOWNLOAD NOW!

Book Synopsis From One Cell: A Journey into Life's Origins and the Future of Medicine by : Ben Stanger

Download or read book From One Cell: A Journey into Life's Origins and the Future of Medicine written by Ben Stanger and published by W. W. Norton & Company. This book was released on 2023-08-08 with total page 448 pages. Available in PDF, EPUB and Kindle. Book excerpt: “Insightful and erudite.”—Adrian Woolfson, Wall Street Journal Inside the quest to unlock the mysteries of development—and find the key to transforming our future. Each of us began life as a single cell. From this humble origin, we embarked on a risky journey fraught with opportunities for disaster. Yet, amazingly, we reached our destination intact, emerging as dazzlingly complex, exquisitely engineered assemblages of trillions of cells. This metamorphosis constitutes one of nature’s most spectacular yet commonplace magic tricks—and one of its most coveted secrets. In From One Cell, physician and researcher Ben Stanger offers a breathtaking glimpse into what scientists are discovering about how life and the body take shape, and how these revelations stand to revolutionize medicine and the future of human health. In vivid prose, Stanger leads readers on a gripping odyssey retracing this universal, yet unremembered, rite of passage. Through the eyes of the scientists unraveling development’s riddles in experiments as painstaking as they are inventive, we confront fascinating puzzles: how does the plethora of different tissues that compose our bodies arise from a single source? How do cells know what they are meant to become—skin or bone, blood or muscle—when all carry the same set of genetic instructions? Once a cell starts developing down one path, can it change its mind, or is its destiny irrevocably sealed? As Stanger shows us, the answers to these questions may at last empower us to solve some of our most persistently confounding medical challenges, from cancer to cognitive decline to degenerative disease. Recognizing tumors as evil doppelgangers of the embryo points the way toward new, more targeted cancer therapies. Learning how cells choose their identities and find their way in space could unlock lifesaving breakthroughs in regenerative medicine. The possibilities are extraordinary. Popular science at its best, From One Cell celebrates the power and beauty of understanding our collective beginnings.

The Dance of Life

Author : Magdalena Zernicka-Goetz
Publisher : Basic Books
ISBN 13 : 1541699041
Total Pages : 304 pages
Book Rating : 4.5/5 (416 download)

DOWNLOAD NOW!

Book Synopsis The Dance of Life by : Magdalena Zernicka-Goetz

Download or read book The Dance of Life written by Magdalena Zernicka-Goetz and published by Basic Books. This book was released on 2020-02-25 with total page 304 pages. Available in PDF, EPUB and Kindle. Book excerpt: A renowned biologist's cutting-edge and unconventional examination of human reproduction and embryo research Scientists have long struggled to make pregnancy easier, safer, and more successful. In The Dance of Life, developmental and stem-cell biologist Magdalena Zernicka-Goetz takes us to the front lines of efforts to understand the creation of a human life. She has spent two decades unraveling the mysteries of development, as a simple fertilized egg becomes a complex human being of forty trillion cells. Zernicka-Goetz's work is both incredibly practical and astonishingly vast: her groundbreaking experiments with mouse, human, and artificial embryo models give hope to how more women can sustain viable pregnancies. Set at the intersection of science's greatest powers and humanity's greatest concern, The Dance of Life is a revelatory account of the future of fertility -- and life itself.

The Healing Cell

Author : Dr. Robin L. Smith
Publisher : Center Street
ISBN 13 : 1455572942
Total Pages : 203 pages
Book Rating : 4.4/5 (555 download)

DOWNLOAD NOW!

Book Synopsis The Healing Cell by : Dr. Robin L. Smith

Download or read book The Healing Cell written by Dr. Robin L. Smith and published by Center Street. This book was released on 2013-04-02 with total page 203 pages. Available in PDF, EPUB and Kindle. Book excerpt: The Healing Cell is an easy to read, carefully researched, and clear-eyed view of medicine many decades in the making that is now paying off with treatments that repair damaged hearts, restore sight, kill cancer, cure diabetes, heal burns, and stop the march of such degenerative diseases as Alzheimer's, multiple sclerosis, and Lou Gehrig's disease. The emotionally and intellectually stimulating stories throughout the book dramatically illustrate that stem cell therapies can change the way we live our lives after being afflicted by a disease or trauma. The book is the result of a unique collaboration between the Vatican's Pontifical Council for Culture and the Stem for Life Foundation. It includes a special address by His Holiness Benedict XVI, urging increased support and awareness for advancements in adult stem cell research.

Food Science and Technology

Author : Oluwatosin Ademola Ijabadeniyi
Publisher : Walter de Gruyter GmbH & Co KG
ISBN 13 : 3110667576
Total Pages : 356 pages
Book Rating : 4.1/5 (16 download)

DOWNLOAD NOW!

Book Synopsis Food Science and Technology by : Oluwatosin Ademola Ijabadeniyi

Download or read book Food Science and Technology written by Oluwatosin Ademola Ijabadeniyi and published by Walter de Gruyter GmbH & Co KG. This book was released on 2020-12-07 with total page 356 pages. Available in PDF, EPUB and Kindle. Book excerpt: Food Science and Technology: Trends and Future Prospects presents different aspects of food science i.e., food microbiology, food chemistry, nutrition, process engineering that should be applied for selection, preservation, processing, packaging, and distribution of quality food. The authors focus on the fundamental aspects of food and also highlight emerging technology and innovations that are changing the food industry. The chapters are written by leading researchers, lecturers, and experts in food chemistry, food microbiology, biotechnology, nutrition, and management. This book is valuable for researchers and students in food science and technology and it is also useful for food industry professionals, food entrepreneurs, and farmers.

The Song of the Cell

Author : Siddhartha Mukherjee
Publisher : Penguin Random House India Private Limited
ISBN 13 : 9354927580
Total Pages : 552 pages
Book Rating : 4.3/5 (549 download)

DOWNLOAD NOW!

Book Synopsis The Song of the Cell by : Siddhartha Mukherjee

Download or read book The Song of the Cell written by Siddhartha Mukherjee and published by Penguin Random House India Private Limited. This book was released on 2022-10-30 with total page 552 pages. Available in PDF, EPUB and Kindle. Book excerpt: From Pulitzer Prize-winning and #1 New York Times bestselling author of The Emperor of All Maladies and The Gene, The Song of The Cell is the third book in this extraordinary writer's exploration of what it means to be human-rich with Siddhartha Mukherjee's revelatory and exhilarating stories of scientists, doctors, and all the patients whose lives may be saved by their work. In the late 1600s, a distinguished English polymath, Robert Hooke, and an eccentric Dutch cloth merchant, Antonie van Leeuwenhoek, look down their handmade microscopes. What they see introduces a radical concept that sweeps through biology and medicine, touching virtually every aspect of the two sciences and altering both forever. It is the fact that complex living organisms are assemblages of tiny, self-contained, self-regulating units. Our organs, our physiology, our selves-hearts, blood, brains-are built from these compartments. Hooke christens them 'cells'. The discovery of cells-and the reframing of the human body as a cellular ecosystem-announced the birth of a new kind of medicine based on the therapeutic manipulations of cells. A hip fracture, a cardiac arrest, Alzheimer's, dementia, AIDS, pneumonia, lung cancer, kidney failure, arthritis, COVID-all could be viewed as the results of cells, or systems of cells, functioning abnormally. And all could be perceived as loci of cellular therapies. In The Song of the Cell, Mukherjee tells the story of how scientists discovered cells, began to understand them, and are now using that knowledge to create new humans. He seduces readers with writing so vivid, lucid, and suspenseful that complex science becomes thrilling. Told in six parts, laced with Mukherjee's own experience as a researcher, doctor, and prolific reader, The Song of the Cell is both panoramic and intimate-a masterpiece.

Brolliology

Author : Marion Rankine
Publisher : Melville House
ISBN 13 : 1612196705
Total Pages : 193 pages
Book Rating : 4.6/5 (121 download)

DOWNLOAD NOW!

Book Synopsis Brolliology by : Marion Rankine

Download or read book Brolliology written by Marion Rankine and published by Melville House. This book was released on 2017-11-07 with total page 193 pages. Available in PDF, EPUB and Kindle. Book excerpt: A fun, illustrated history of the umbrella's surprising place in life and literature Humans have been making, using, perfecting, and decorating umbrellas for millennia--holding them over the heads of rulers, signalling class distinctions, and exploring their full imaginative potential in folk tales and novels. In the spirit of the best literary gift books, Brolliology is a beautifully designed and illustrated tour through literature and history. It surprises us with the crucial role that the oft-overlooked umbrella has played over centuries--and not just in keeping us dry. Marion Rankine elevates umbrellas to their rightful place as an object worthy of philosophical inquiry. As Rankine points out, many others have tried. Derrida sought to find the meaning (or lack thereof) behind an umbrella mentioned in Nietzsche's notes, Robert Louis Stevenson wrote essays on the handy object, and Dickens used umbrellas as a narrative device for just about everything. She tackles the gender, class, and social connotations of carrying an umbrella and helps us realize our deep connection to this most forgettable everyday object--which we only think of when we don't have one.

The Secret Language of Cells

Author : Jon Lieff
Publisher : BenBella Books
ISBN 13 : 1948836041
Total Pages : 0 pages
Book Rating : 4.9/5 (488 download)

DOWNLOAD NOW!

Book Synopsis The Secret Language of Cells by : Jon Lieff

Download or read book The Secret Language of Cells written by Jon Lieff and published by BenBella Books. This book was released on 2020-09-22 with total page 0 pages. Available in PDF, EPUB and Kindle. Book excerpt: Your cells are talking about you. Right now, both your inner and outer worlds are abuzz with chatter among living cells of every possible kind—from those in your body and brain to those in the environment around you. From electrical alerts to chemical codes, the greatest secret of modern biology, hiding in plain sight, is that all of life's activity boils down to one thing: conversation. While cells are commonly considered the building block of living things, it is actually the communication between cells that brings us to life, controlling our bodies and brains, determining whether we are healthy or sick, and directly influencing how we think, feel, and behave. In The Secret Language of Cells, doctor and neuroscientist Jon Lieff lets us listen in on these conversations, and reveals their significance for everything from mental health to cancer. He explains the surprising science of how very different cells—bacteria and brain cells, blood cells and viruses—all speak the same language. This overarching principle has been long overlooked because scientific journals use impenetrable jargon that makes it hard to be understood across disciplines, much less by the general public. Lieff presents a fascinating and accessible look into cellular communication science—a groundbreaking and comprehensive exploration of this biological phenomenon. In these pages, discover the intriguing lives of cells as they ask questions, get answers, give feedback, gather information, call for each other, and make complex decisions. During infections, immune T-cells tell brain cells that we should "feel sick" and lie down. Cancer cells warn their community about immune and microbe attacks. Gut cells talk with microbes to determine which are friends and which are enemies, and microbes talk with each other and with much more complicated human cells in ways that determine which medicines work and which will fail. With applications for immunity, chronic pain, weight loss, depression, cancer treatment, and virtually every aspect of health and biology, cellular communication is revolutionizing our understanding not just of disease, but of life itself. The Secret Language of Cells is required reading for anyone interested in following the conversation.

Stem Cells Made Easy

Author : Jon Adams
Publisher : Green Mountain Computing
ISBN 13 :
Total Pages : 141 pages
Book Rating : 4./5 ( download)

DOWNLOAD NOW!

Book Synopsis Stem Cells Made Easy by : Jon Adams

Download or read book Stem Cells Made Easy written by Jon Adams and published by Green Mountain Computing. This book was released on with total page 141 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'Stem Cells Made Easy,' a comprehensive guide designed to navigate you through the fascinating world of stem cells from A to Z. This book is tailored to illuminate one of science's most profound topics using a tapestry of deep analogies and vivid examples, making complex concepts not only palpable but also engaging. From the basics of what stem cells are to the intricate details of how they can be used in medicine and research, 'Stem Cells Made Easy' peels back the layers of scientific jargon to reveal the core principles at play in regenerative biology. We'll embark on a journey exploring how these cellular marvels hold the key to unlocking new medical treatments and understanding human development. You can expect to gain a solid foundation in stem cell knowledge, enriched with relatable analogies that lend clarity to advanced subjects. Each chapter is a building block, leading you confidently through the intricacies of stem cell types, their natural behaviors, and the cutting-edge techniques for manipulating them in the lab. This book is a bridge between lay interest and professional-level comprehension, providing insights into the latest scientific findings while remaining rooted in everyday language and imagery. Whether you're a student, an educator, a healthcare professional, or a curious mind driven by the wonders of biology, 'Stem Cells Made Easy' promises a captivating and educational experience that will not only educate but inspire. Contents: 1. The Stem Cell Universe (Pg 6): Dive into the vast world of stem cells and understand their fundamental role in biology and medicine. 2. The Lifecycle of a Stem Cell (Pg 17): Explore the journey of a stem cell from its origin to its various stages of development and differentiation. 3. The Blueprint of Life (Pg 28): Uncover the genetic blueprints that govern stem cell behavior and potential. 4. Regeneration and Healing (Pg 40): Learn how stem cells contribute to the body's ability to regenerate tissues and heal injuries. 5. Stem Cells in Research (Pg 51): Delve into the cutting-edge research utilizing stem cells to advance scientific knowledge and medical treatments. 6. Ethical Considerations (Pg 62): Navigate the complex ethical landscape surrounding stem cell research and its applications. 7. Stem Cells and Modern Medicine (Pg 76): Discover how stem cells are revolutionizing modern medicine and the treatment of various diseases. 8. Future Horizons (Pg 89): Look ahead at the promising future of stem cell technology and its potential to transform healthcare. 9. The Layman's Laboratory (Pg 102): Gain practical insights into how stem cell research can be understood and appreciated by non-specialists. Embark on an enlightening journey with 'Stem Cells Made Easy,' and unlock the mysteries of these remarkable cells that hold the keys to the future of medicine and human health.

So Simple a Beginning

Author : Raghuveer Parthasarathy
Publisher : Princeton University Press
ISBN 13 : 0691200408
Total Pages : 336 pages
Book Rating : 4.6/5 (912 download)

DOWNLOAD NOW!

Book Synopsis So Simple a Beginning by : Raghuveer Parthasarathy

Download or read book So Simple a Beginning written by Raghuveer Parthasarathy and published by Princeton University Press. This book was released on 2022-02-08 with total page 336 pages. Available in PDF, EPUB and Kindle. Book excerpt: A biophysicist reveals the hidden unity behind nature’s breathtaking complexity The form and function of a sprinting cheetah are quite unlike those of a rooted tree. A human being is very different from a bacterium or a zebra. The living world is a realm of dazzling variety, yet a shared set of physical principles shapes the forms and behaviors of every creature in it. So Simple a Beginning shows how the emerging new science of biophysics is transforming our understanding of life on Earth and enabling potentially lifesaving but controversial technologies such as gene editing, artificial organ growth, and ecosystem engineering. Raghuveer Parthasarathy explains how four basic principles—self-assembly, regulatory circuits, predictable randomness, and scaling—shape the machinery of life on scales ranging from microscopic molecules to gigantic elephants. He describes how biophysics is helping to unlock the secrets of a host of natural phenomena, such as how your limbs know to form at the proper places, and why humans need lungs but ants do not. Parthasarathy explores how the cutting-edge biotechnologies of tomorrow could enable us to alter living things in ways both subtle and profound. Featuring dozens of original watercolors and drawings by the author, this sweeping tour of biophysics offers astonishing new perspectives on how the wonders of life can arise from so simple a beginning.

Creation

Author : Adam Rutherford
Publisher : Penguin UK
ISBN 13 : 0141970227
Total Pages : 272 pages
Book Rating : 4.1/5 (419 download)

DOWNLOAD NOW!

Book Synopsis Creation by : Adam Rutherford

Download or read book Creation written by Adam Rutherford and published by Penguin UK. This book was released on 2013-04-04 with total page 272 pages. Available in PDF, EPUB and Kindle. Book excerpt: 'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

The Search for Life's Origins

Author : National Research Council
Publisher : National Academies Press
ISBN 13 : 0309042461
Total Pages : 161 pages
Book Rating : 4.3/5 (9 download)

DOWNLOAD NOW!

Book Synopsis The Search for Life's Origins by : National Research Council

Download or read book The Search for Life's Origins written by National Research Council and published by National Academies Press. This book was released on 1990-02-01 with total page 161 pages. Available in PDF, EPUB and Kindle. Book excerpt: The field of planetary biology and chemical evolution draws together experts in astronomy, paleobiology, biochemistry, and space science who work together to understand the evolution of living systems. This field has made exciting discoveries that shed light on how organic compounds came together to form self-replicating molecules-the origin of life. This volume updates that progress and offers recommendations on research programs-including an ambitious effort centered on Mars-to advance the field over the next 10 to 15 years. The book presents a wide range of data and research results on these and other issues: The biogenic elements and their interaction in the interstellar clouds and in solar nebulae. Early planetary environments and the conditions that lead to the origin of life. The evolution of cellular and multicellular life. The search for life outside the solar system. This volume will become required reading for anyone involved in the search for life's beginnings-including exobiologists, geoscientists, planetary scientists, and U.S. space and science policymakers.

The Immortal Life of Henrietta Lacks

Author : Rebecca Skloot
Publisher : Crown
ISBN 13 : 0307589382
Total Pages : 386 pages
Book Rating : 4.3/5 (75 download)

DOWNLOAD NOW!

Book Synopsis The Immortal Life of Henrietta Lacks by : Rebecca Skloot

Download or read book The Immortal Life of Henrietta Lacks written by Rebecca Skloot and published by Crown. This book was released on 2010-02-02 with total page 386 pages. Available in PDF, EPUB and Kindle. Book excerpt: #1 NEW YORK TIMES BESTSELLER • “The story of modern medicine and bioethics—and, indeed, race relations—is refracted beautifully, and movingly.”—Entertainment Weekly NOW A MAJOR MOTION PICTURE FROM HBO® STARRING OPRAH WINFREY AND ROSE BYRNE • ONE OF THE “MOST INFLUENTIAL” (CNN), “DEFINING” (LITHUB), AND “BEST” (THE PHILADELPHIA INQUIRER) BOOKS OF THE DECADE • ONE OF ESSENCE’S 50 MOST IMPACTFUL BLACK BOOKS OF THE PAST 50 YEARS • WINNER OF THE CHICAGO TRIBUNE HEARTLAND PRIZE FOR NONFICTION NAMED ONE OF THE BEST BOOKS OF THE YEAR BY The New York Times Book Review • Entertainment Weekly • O: The Oprah Magazine • NPR • Financial Times • New York • Independent (U.K.) • Times (U.K.) • Publishers Weekly • Library Journal • Kirkus Reviews • Booklist • Globe and Mail Her name was Henrietta Lacks, but scientists know her as HeLa. She was a poor Southern tobacco farmer who worked the same land as her slave ancestors, yet her cells—taken without her knowledge—became one of the most important tools in medicine: The first “immortal” human cells grown in culture, which are still alive today, though she has been dead for more than sixty years. HeLa cells were vital for developing the polio vaccine; uncovered secrets of cancer, viruses, and the atom bomb’s effects; helped lead to important advances like in vitro fertilization, cloning, and gene mapping; and have been bought and sold by the billions. Yet Henrietta Lacks remains virtually unknown, buried in an unmarked grave. Henrietta’s family did not learn of her “immortality” until more than twenty years after her death, when scientists investigating HeLa began using her husband and children in research without informed consent. And though the cells had launched a multimillion-dollar industry that sells human biological materials, her family never saw any of the profits. As Rebecca Skloot so brilliantly shows, the story of the Lacks family—past and present—is inextricably connected to the dark history of experimentation on African Americans, the birth of bioethics, and the legal battles over whether we control the stuff we are made of. Over the decade it took to uncover this story, Rebecca became enmeshed in the lives of the Lacks family—especially Henrietta’s daughter Deborah. Deborah was consumed with questions: Had scientists cloned her mother? Had they killed her to harvest her cells? And if her mother was so important to medicine, why couldn’t her children afford health insurance? Intimate in feeling, astonishing in scope, and impossible to put down, The Immortal Life of Henrietta Lacks captures the beauty and drama of scientific discovery, as well as its human consequences.

The Gene

Author : Siddhartha Mukherjee
Publisher : Simon and Schuster
ISBN 13 : 1476733538
Total Pages : 624 pages
Book Rating : 4.4/5 (767 download)

DOWNLOAD NOW!

Book Synopsis The Gene by : Siddhartha Mukherjee

Download or read book The Gene written by Siddhartha Mukherjee and published by Simon and Schuster. This book was released on 2016-05-17 with total page 624 pages. Available in PDF, EPUB and Kindle. Book excerpt: The #1 NEW YORK TIMES Bestseller The basis for the PBS Ken Burns Documentary The Gene: An Intimate History Now includes an excerpt from Siddhartha Mukherjee’s new book Song of the Cell! From the Pulitzer Prize–winning author of The Emperor of All Maladies—a fascinating history of the gene and “a magisterial account of how human minds have laboriously, ingeniously picked apart what makes us tick” (Elle). “Sid Mukherjee has the uncanny ability to bring together science, history, and the future in a way that is understandable and riveting, guiding us through both time and the mystery of life itself.” —Ken Burns “Dr. Siddhartha Mukherjee dazzled readers with his Pulitzer Prize-winning The Emperor of All Maladies in 2010. That achievement was evidently just a warm-up for his virtuoso performance in The Gene: An Intimate History, in which he braids science, history, and memoir into an epic with all the range and biblical thunder of Paradise Lost” (The New York Times). In this biography Mukherjee brings to life the quest to understand human heredity and its surprising influence on our lives, personalities, identities, fates, and choices. “Mukherjee expresses abstract intellectual ideas through emotional stories…[and] swaddles his medical rigor with rhapsodic tenderness, surprising vulnerability, and occasional flashes of pure poetry” (The Washington Post). Throughout, the story of Mukherjee’s own family—with its tragic and bewildering history of mental illness—reminds us of the questions that hang over our ability to translate the science of genetics from the laboratory to the real world. In riveting and dramatic prose, he describes the centuries of research and experimentation—from Aristotle and Pythagoras to Mendel and Darwin, from Boveri and Morgan to Crick, Watson and Franklin, all the way through the revolutionary twenty-first century innovators who mapped the human genome. “A fascinating and often sobering history of how humans came to understand the roles of genes in making us who we are—and what our manipulation of those genes might mean for our future” (Milwaukee Journal-Sentinel), The Gene is the revelatory and magisterial history of a scientific idea coming to life, the most crucial science of our time, intimately explained by a master. “The Gene is a book we all should read” (USA TODAY).

Unique Philosophy Book- Cosmocellular-Hypothesis: A Journey from Meditation to Modern-Medicine (Volume-1-C)

Author : Dr. Kamlesh N Patel
Publisher : Dhruv Publication (Self Publication)
ISBN 13 : 9356029067
Total Pages : 614 pages
Book Rating : 4.3/5 (56 download)

DOWNLOAD NOW!

Book Synopsis Unique Philosophy Book- Cosmocellular-Hypothesis: A Journey from Meditation to Modern-Medicine (Volume-1-C) by : Dr. Kamlesh N Patel

Download or read book Unique Philosophy Book- Cosmocellular-Hypothesis: A Journey from Meditation to Modern-Medicine (Volume-1-C) written by Dr. Kamlesh N Patel and published by Dhruv Publication (Self Publication). This book was released on with total page 614 pages. Available in PDF, EPUB and Kindle. Book excerpt: Welcome to still-unwritten-phenomena showing Nonmolecularly-Molecular Cosmocellular-World. Read a special & unique book (Cosmocellular-Hypothesis). No one would have ever read it before. This same Cosmocellular-Message you had read before 30 billion years, and will also read after 30 billion years,.....How it's possible according to universal Ancient-Vedic-Law of the Time-Replication & Thermodynamics-Laws of the Modern-Science (Waves-physics)? Indeed, all kind of the plant-kingdoms & animal-kingdoms on the earth, had reproduced , are reproducing & will reproduce from their same species only. Thus, our ancestors were not apes, but they were same as we look today. ..... How according to such joint-theory of cosmocellular-ancestory (and waves- &-particles-physics) as well as cytocosmic-ancestory, ---- can trace back us to Vedic-belief or philosophical-belief (which strongly prevailed before Charles Darwin) about the evolution of life on the earth that each living-species evolved separately & that none had changed their forms? That means, how a man evolved from a man only ,not from the ape or other species. In other words, man has descended from man only , & rat from rat only; similarly a banyan tree from banyan-tree only, & mango-tree from mango-tree only etc.etc. ? In short, a babool or banyan tree never never gives mango-fruit. ....... www.cosmocellular.com

The Genome Odyssey

Author : Dr. Euan Angus Ashley
Publisher : Celadon Books
ISBN 13 : 1250234972
Total Pages : 221 pages
Book Rating : 4.2/5 (52 download)

DOWNLOAD NOW!

Book Synopsis The Genome Odyssey by : Dr. Euan Angus Ashley

Download or read book The Genome Odyssey written by Dr. Euan Angus Ashley and published by Celadon Books. This book was released on 2021-02-23 with total page 221 pages. Available in PDF, EPUB and Kindle. Book excerpt: In The Genome Odyssey, Dr. Euan Ashley, Stanford professor of medicine and genetics, brings the breakthroughs of precision medicine to vivid life through the real diagnostic journeys of his patients and the tireless efforts of his fellow doctors and scientists as they hunt to prevent, predict, and beat disease. Since the Human Genome Project was completed in 2003, the price of genome sequencing has dropped at a staggering rate. It’s as if the price of a Ferrari went from $350,000 to a mere forty cents. Through breakthroughs made by Dr. Ashley’s team at Stanford and other dedicated groups around the world, analyzing the human genome has decreased from a heroic multibillion dollar effort to a single clinical test costing less than $1,000. For the first time we have within our grasp the ability to predict our genetic future, to diagnose and prevent disease before it begins, and to decode what it really means to be human. In The Genome Odyssey, Dr. Ashley details the medicine behind genome sequencing with clarity and accessibility. More than that, with passion for his subject and compassion for his patients, he introduces readers to the dynamic group of researchers and doctor detectives who hunt for answers, and to the pioneering patients who open up their lives to the medical community during their search for diagnoses and cures. He describes how he led the team that was the first to analyze and interpret a complete human genome, how they broke genome speed records to diagnose and treat a newborn baby girl whose heart stopped five times on the first day of her life, and how they found a boy with tumors growing inside his heart and traced the cause to a missing piece of his genome. These patients inspire Dr. Ashley and his team as they work to expand the boundaries of our medical capabilities and to envision a future where genome sequencing is available for all, where medicine can be tailored to treat specific diseases and to decode pathogens like viruses at the genomic level, and where our medical system as we know it has been completely revolutionized.

The Emperor of All Maladies

Author : Siddhartha Mukherjee
Publisher : Simon and Schuster
ISBN 13 : 1439170916
Total Pages : 624 pages
Book Rating : 4.4/5 (391 download)

DOWNLOAD NOW!

Book Synopsis The Emperor of All Maladies by : Siddhartha Mukherjee

Download or read book The Emperor of All Maladies written by Siddhartha Mukherjee and published by Simon and Schuster. This book was released on 2011-08-09 with total page 624 pages. Available in PDF, EPUB and Kindle. Book excerpt: Winner of the Pulitzer Prize and a documentary from Ken Burns on PBS, this New York Times bestseller is “an extraordinary achievement” (The New Yorker)—a magnificent, profoundly humane “biography” of cancer—from its first documented appearances thousands of years ago through the epic battles in the twentieth century to cure, control, and conquer it to a radical new understanding of its essence. Physician, researcher, and award-winning science writer, Siddhartha Mukherjee examines cancer with a cellular biologist’s precision, a historian’s perspective, and a biographer’s passion. The result is an astonishingly lucid and eloquent chronicle of a disease humans have lived with—and perished from—for more than five thousand years. The story of cancer is a story of human ingenuity, resilience, and perseverance, but also of hubris, paternalism, and misperception. Mukherjee recounts centuries of discoveries, setbacks, victories, and deaths, told through the eyes of his predecessors and peers, training their wits against an infinitely resourceful adversary that, just three decades ago, was thought to be easily vanquished in an all-out “war against cancer.” The book reads like a literary thriller with cancer as the protagonist. Riveting, urgent, and surprising, The Emperor of All Maladies provides a fascinating glimpse into the future of cancer treatments. It is an illuminating book that provides hope and clarity to those seeking to demystify cancer.

Flesh Made New

Author : John Rasko
Publisher : HarperCollins Australia
ISBN 13 : 1460711467
Total Pages : 285 pages
Book Rating : 4.4/5 (67 download)

DOWNLOAD NOW!

Book Synopsis Flesh Made New by : John Rasko

Download or read book Flesh Made New written by John Rasko and published by HarperCollins Australia. This book was released on 2021-02-01 with total page 285 pages. Available in PDF, EPUB and Kindle. Book excerpt: The dazzling promise of stem cell medicine: does it work and will it save us? Two experts look at the hype For decades, we've been anticipating the dawn of regenerative medicine. Again and again, we've been promised that stem cells will soon cure just about every ill imaginable. If not tomorrow, then the next day, or the day after that, and so on. We're still waiting. This book is an antidote to hype and a salve to soothe the itch for stem-cell salvation. In it, Professor John Rasko, a leading physician-scientist, and writer-historian Carl Power take us on a wild historical tour of this scandal-prone field. They expose all the dirty little secrets that the hype merchants prefer to ignore - the blunders and setbacks, confusions and delusions, tricks and lies. You'll meet Alexis Carrel, who discovered how to cultivate cells in a test tube: celebrity surgeon, scientific genius and suspected Nazi sympathiser, he opened the field of modern cell science with an experiment so bogus it blocked the way forward for the next 50 years. You'll meet Don Thomas, who developed bone marrow transplantation - the first successful stem-cell therapy - but only after a miserable decade in which most of his patients died. Alongside true stem-cell pioneers, you'll meet charlatans who cooked their data and claimed fake cures - sometimes with fatal consequences. Is there any good news? Which of the many promises of stem-cell research have been kept? And what of the future? Rasko and Power insist that we can only know where we're going if we have a sense of where we've been. Their study tears down the hype surrounding stem cells in order to reveal what's still worth hoping for. PRAISE 'If you love some scandal with your science - or some science with your scandal - this is THE book for you. Brilliant stuff' Adam Spencer, University of Sydney 'Science, skulduggery and snake oil salesmen ... it is a revolution in medicine but who knew the story of stem cell science was such a ripping yarn!' Fran Kelly, ABC Radio National Breakfast 'Science isn't magic: it's a human enterprise. This enthralling book tells of high achievement and astonishing blunders in a vital field of research' Robyn Williams, science journalist and broadcaster 'A masterpiece in myth-busting which helps separate fact from fiction in the world of regenerative medicine. It shines a light on some episodes in medical history many would rather forget but also shows a way forward for stem cell research breakthroughs grounded in solid science' Sophie Scott, national medical reporter, ABC 'The stem cell revolution: myths, mistakes but mighty medical masterpiece' Sir Gustav Nossal, AC CBE FRS FAA, Australian of the Year 2000 'A compelling (and compulsory) read for anyone entranced by the latest media-promoted breakthroughs in medical research, or planning translation of new biomedical research into clinical practice' Ian Frazer, AC, FRCPE, FRCPA, FAA, FTSE Australian of the Year 2006, Australian Living Treasure 2012 'Is it really stem cells' turn to revolutionise health care? When you come across a train wreck, keep reading! You'll discover that stem cells reveal medicine in its most provocative and challenging light' Antony Basten AO FAA FTSE 'Flesh Made New is a revelation for the general reader about what lies beneath the surface of exciting scientific advances ... The book shows the value of patience and trust in robust evidence-based scientific research, and where things go off the rail, for whistleblowers and experts like the authors of this book' Lucy Turnbull AO, businesswoman, urbanist and philanthropist